String fullTitle = 'undefined';
int postNumber = 37707189;
String image = '1713238690403887.jpg';
String date = '04/15/24(Mon)23:38:10';
String comment = 'WEREWOLF Thread';
'>>37707189
we already have a thread OP >>37671832';
'>>37707381
More the marrier';
'>>37707387
aawwwooooooo';
'>>37707189
Lets kill all of the evil together lest i smite all of you. Now like phinehas';
'It is good for brothers to dwell together in peace';
'yip';
'>>37707434
What do u want';
'>>37707443
in what context is this question?';
'I welcome the werewolf threads, all the vamp threads filled with larp fangs';
'>>37707454
All of the context i legitimately want to know what you desire and am not trying to be rude i apologies';
'>>37707463
I...idk sorry';
'>>37707189
They ain't real buddy';
'I hope there isn't a furry in my thread...';
'>>37707484
Ok thats ok just curious. I would be freaked out if u said something else';
'>>37707518
Yea you aint real';
'>>37707533
I'm not a werewolf so that's not a problem for me';
'>>37707541
Thats just what a robot would say. How clever';
'>>37707541
You are like 80% not real';
'>>37707547
Nuh uh. And I'm not a vampire either. So don't bother accusing me.
>>37707549
Rude';
'>>37707553
Same thing happened in my dream. I said hey im dreaming and dream people lied and said i wadn't';
'What if god actually only made one other person';
'>>37707400
you can kill those two having a nothingburger argument';
'See how yer logic falls apart. Yer fake';
'>>37707577
Thats why this is not real: you are irrational. *mic drop*';
'>>37707585
Nothingburger, come back to me when you get some hapeningsauce';
'>>37707589
No i dont believe you exist you are extraordinarily irrational';
'>>37707594
I don't mind that you don't believe, I am however bothered by there possibly being a furry here';
'>>37707605
If you were real you would mind it';
'I think you are fake and you got me to agree to this false reality because i am nice. This is all bulllshit and its obvious';
'>>37707189GTAGCTACGTACGTGACTGACTGGCTA
;
>WEREWOLF Thread
very simple to become, CRISPR gene activation of old transposon system crica Z17
ACCGAGGGTAGATGCGCGCTACTGCCCGGCTCTAC
BLAST it, see where it takes you'
'>>37707655
How ridiculous';
'>>37707624
They are real bro';
'>>37707189
I had just had a dream where I had a romantic encounter with a wolf man but I was mostly scared because his teeth were really sharp and strong and I was scared of them but I still wanted to be romantic with the wolf man but his sharp teeth made it really hard plus he was really cute';
'>>37707605
You are definitely a Furry.';
'>>37707189
God, I want for a werewolf to pin me down and hold me in place as he tears apart clothes and brutally rapes me. Ideally, a whole pack of werewolves.';
'>>37708398
>>37708400
>>37708407
craziest blunt rotation';
'>>37708407
fuck';
'>>37708452
Exactly!';
'>>37707189
Are all these damn furry threads because the elites are feeling the damn Furries Aryan spirit awakening or something, because if that's the case you feds need to go and start locking the woods down because pretty soon we are going to have actual beast men walking around and it's your job to clean it up, we pay you tax money to fix that shit before it gets out of hand. Get off 4chan and Get innawoods so we don't have to deal with beast men, feds. Please and thank you.';
'>>37707411hcFFjrYA' ;
To be a Monster of God
https://www.youtube.com/watch?v=c_P
'>>37708730
What';
'undefined';
'>>37707411
based';
'>>37707189
FMliNTNk
;
Thread theme:
https://www.youtube.com/watch?v=WeL
I made this video btw X)'
'I'm kind of curious, there are currently two active werewolf threads and in the past month there have been multiple therian threads, is something happening?';
'>>37711829
Not very many people are actually therians so they make a furry larp thread instead.';
'>>37711875
at least they are straight';
'>>37711910
I'm really gay lol';
'>>37711953
oof';
'Funny enough my mental barriers manifest in some sort of wolflike rage, I have been attacked I my dreams and Astral proyection, I have faded memories of ripping apart these negative entities and running and jumping in fours, when I feel their malicious energy rather than cower in fear, I'm flooded with murderous rage. They leave me alone.';
'>>37712254
Anon, they feed off of rage.';
'https://www.youtube.com/watch?v=sAm8QoSyA6A' ;
'>>37712306
peachfuzz uwu';
'>>37707189
More like wereWIFE thread, know what I mean?';
'>>37707411kKSaI9EQ' ;
https://www.youtube.com/watch?v=6al
'>>37713125
Sometimes it's great keeping your thoughts to yourself, I would know';
'>>37713209
Bros larping as a pokemon';
'>>37713801
I'm not your bro';
'where can i find a pack to chill with';
'>>37709911
They know what I'm talking about, it's ok, you don't need to know if they do their job.';
'>>37707541
That’s what a werewolf would say';
'Had a werewolf with glowing yellow eyes visit me in a dream.';
'werewolf gf';
'>>37714686
your werewolf gf is hiding within your walls, you gots to knock them walls down nigga!';
'>>37714134
That's what a werewolf trying to accuse someone else of being a werewolf would say. Stop projecting.';
'>>37714291
same anon, mine is sorta like op pic, but more misty / shadow like, yellow eyes and white teeth with that twisted snarled face, never hurts me tho';
'>>37716564
>>37714291
oh, and i forgot to mention i see it when im awake / half awake too(like once a week), its like a sleep paralysis demon but, uh, more horny, dont wanna go into details';
'>>37708730
do you think werewolves are part of the half animal hybrid Nephilims ?';
'>>37707189
do NOT seek the werewolf tapes. fucked me up for years';
'>>37718795
i just searched this and all i found was gay werewolf furry bondage pictures';
'>>37718800
a former friend showed me it around 2010-2011. seriously fucked up, i hope it was fake';
'>>37719274
What are they?';
'There is a show about anomalous people, ghost and so on an german TV. Was translated but in origin us or UK. There was a show about a African boy that howled, stretched its back, bend over, screamed in pain (all on camera), different channels Interview that boy too, - and somehow he got very long teeth (like an vampire, therefore they called him the vampire boy from Africa). But like his back stretched to nearly breaking, his pain and afterward total... Yeah like.. "im total empty and have to sleep... Im out powered"... That boy is an werewolf. He even showed how his teeth went from normal to super long and very pointy and sharp. I played frame by frame (was on YouTube, downloaded it, was years ago), and what the camera guy and the team of this show seemed to make it up as an "mysterious - but propably scam-story" not seen, obviously, is, was, that the teeth really grow inside his open mouth. He even joked with that in front of his friends cause he was some of a spectacle in his little village and had to do it everytime people asked for. You know.. For.. Amusement.
That boy, like maybe 15 was in total pain in that event but OK afterwards.';
'>>37719349
if you still have it anon, can you make a webm?';
'>>37707454
vampires are more gay';
'Ayo deez mf spooky af. Why yall wypipo go in da woods n sheeit. Dis mf jus be waitn fo yo ass';
'>>37719274
Got a link?';
'>>37718800
Got a link?';
'>>37721014
wypipo wanna fuk dat';
'>>37714134
uwu';
'>>37719896
Sadly no. Could find the docu but it was a german translation of a US show, similar to ancient aliens and all like that.
But I found a short vid, picrel. I won't go on TikTok, so it's up to you I guess.. Sorry..
As you see I had too search "vampire" but it's definitely a werewolf. And this vid is only a 1 minute clip, the original was a 15 minutes docu about him.
I don't know if it's the exact scene (slightly from the side, he shows more of his left cheek while opening his mouth letting his teeth grow). Frame by frame you see it's not a fake. Of course, I'd you just look quickly and know it's a poor boy you would think it's fake to make money.
But.. As said.. There is a much longer vid out there.. With guys interviewing him, and him showing it to his buddies etc.';
'>>37725570
Aah one thing, if it was confusing: Picrel of my former post was a visited link, I clicked it, but, I won't make an account on TikTok just to look one video that is nevertheless a short one.. :-/';
'Yo this thread funny asf';
'>>37723328
Yes.';
'imagine the smell';
'whose a good girl??';
'>>37732703
Is mal0 real bros';
'>>37707189
>Wake up
>need to go downstairs
>see OP pic
what do /x/?';
'>>37734771
fuckin abos broke in again';
'>>37734800
typical coons';
'>>37732703
need';
'post some bloody dogman greentexts fore I piss meself';
'>>37707434
>>37712012
>>37714686
>>37732703
Custodian of /x/, please move this thread to the /trash/, thank you.';
'>>37708407
this but the werewolf is a girl';
'>>37736733
with a physiology like a hyena?';
'>>37736746
PERHAPS
post hyena';
'>>37736752
alpha female hyenas grow out their clits and peg lesser males';
'>>37736760
that’s gay';
'>>37707189
i dont know what it is about the op image but my mind registers it as a chick, and it’s turning me on';
'>>37736888
based';
'>>37736888
can’t believe this got trips';
'how to LoA werewolf gf, there is no LoA general';
'>>37707189
Damn, what a dump. Why can't werewolves live anywhere nice?';
'>>37708407
Just like that.';
'>>37737967
too hot for /x/ settle down anon dayum';
'>>37737967
wish that was my pov, does it make me gay??';
'I'd think realistically you'd die of exhaustion if it was 14 werewolves';
'>>37738768
most of them would just finish on you';
'>>37738815
>>37738768
Nah, you would survive because at some point you would contract lycanthropy like a STD and transform.
If it strictly has to be a bite, I'm sure a few of them will get nippy with you anyways';
'>>37738844
How do you summon a werewolf gangbang?';
'>>37738844
become the were-whore';
'>>37738989
Imagine being the new one in the pack, the absolute permanent bottom on the hierarchy';
'>>37739031
hot';
'>>37737967
Bruh';
'>>37707434
yiff in hell furfag';
'>>37739845
werewolves are not furry';
'>>37707189
I had a dream a man with goat legs who claimed to be the god of forests and monsters turned me into a wolf';
'Shut the hell up';
'>>37740989
Back to /vp/ and the gooner rp /pmd/ threads with you.';
'>>37741006
said the pot to the kettle';
'>>37741243
Yeah, how do you think I know anon? Also the Lycanroc thread sucks ass. :^)';
'>>37741248
Hell yeah it does';
'>>37707189
I used to be a werewolf, but I'm alright nowuuuuuuuuuuuuu';
'>>37736888
Trips of truth. Female werewolf with hyenid pseudopenis confirmed.';
'>>37742253
totaly str8 tho rite?';
'>>37707434
cringe';
'>>37742972
we don't care about that shit around these parts bro';
'>>37725570
so somehow the tread is about werewolfs but nobody want to see a vid about it.
i WONT make a webm about a almost 15-30 min vid - this one is what you get for free so to say. But i dont see any answer"
wow.
thats what /x/ is now.. a bunch of pickers - if its not served on your table you acting like rick stubborn kids...
sad.';
'undefined';
'finally somewhere i belong';
'Werewolf gf AND bf';
'>>37746839
This. So much this!';
'>>37707189
doggy :D';
'>>37746839
you watch and play with the puppies?';
'>>37749865
fella is hungry, just let him have a piece of cheeseburger';
'>>37751072
Does chocolate kill werewolves if they consume it?';
'>>37744677
werewolf titties';
'>>37708407
God yes need a werewolf daddy or futa mommy to ravage and keep me as their personal pet and rapetoy
Before anyone asks, yes I'm a furfag';
'>>37737967
Source please';
'>>37739845
Furries literally help run and maintain the internet, and thus hellhole of a site so calm down
2016 called, they want their furry hate back';
'>>37752545
post proof
also, furry hate never died, it just transformed';
'>>37754134
Don't need to lol, IT Jobs are literally filled with furries lmao
If you know you know';
'>>37718781
Yes, or to be more precise could have been.';
'undefined';
'>werewolf
imagine creating a fictional character that becomes its own sexual fetish industry. that's quite an accomplishment.';
'>>37707189
Why are they so sexy tho?';
'>>37752545
Hellish and also true. Just like weird Star Trek sex perverts ran the internet from the internet from the 90's to the early 2010's, since then it's been furries all the way down. Super smart autists always become maladjusted freaks if you don't limit the media they consume. You expose them to a single thing that sparks a neuron in their brain incorrectly, and it's game over, you've got a 132 IQ dog fucking communist tech bro on your hands.';
'>>37755262
W O U L D
>>37755676
ok vampirefag';
'>>37707189
I wish modern media were depiction werewolves as more scarier and deadlier becouse, after all, werewolves, aside of being furries, they're monsters first and foremost in concept and I big fan of monsters in design wise. I even draw this mutant werewolf monstrosity chick from my childhood show that made me to see werewolves as an awesome beasts creatures.';
'>>37758545
would';
'>>37737967
this is way too much holyshit';
'>>37736723
Who do you think made this thread lol';
'Werewolves would be so easy to defeat. Only really strong on full moons and vulnerable to silver bullets. Sorry to burst your bubble but any normal handgun can hold like 15 silver bullets in a magazine. Vampires with standard capacity mags would make quick work of werewolves with their superhuman reflexes combined with silver bullets.';
'>>37762117
ok but imagine the sex with them though';
'>>37762130
Okay you're right.';
'>>37762117
The problem for werewolves isn't that they're hard to kill but that they're also people most of the time';
'>>37762149
Yeah I was thinking more of werewolves that can change almost on demand but have buffs during a full-moon. But also, as the other anon mentioned, imagine the sex. Big werewolf juggs. I'll always be team vamp but damn.';
'>>37707189
So... hypothetical question; would it be considered morally dubious to skin and tan the hide of a of werewolf and hang it on my wall, should I smite one in combat?';
'>>37707189
Your damn picture made me jump.
My gf and I were on a hill the other night drinking beers, cooking brauts and telling scary stories. When we got to the skinwalker stories, one of the motion sensor lights I bring along lit up with nothing there. So we packed up and left, we left most of the stuff up there except the phones and guns.
That night I had a dream of a skinwalker crouching on top of a truck, it looked exactly like your pic (this is the first time I'm seeing this picture). In the dream I told my gf "come look at this", I closed the curtain and opened it again and the skinwalker was now face to face with me at the window. It stared at me and I had to force my head and eyes to stare back. Then I woke up and stayed up till sunrise.
t. Navajo on Navajo Rez, northern AZ area';
'>>37737967
goddamn';
'>>37752530
MetalFoxT';
'>>37764147
thx';
'>>37762172
why not get vamp and werewolf to team up, and make vampire werewolf litters?';
'>>37762952
You're a white kid who lives in like Pennsylvania or something stfu';
'>>37767198
>white kid
spotted the white-hating browniod/tranny / combination of both';
'>>37767341
I'm also White. If I was any of those things I wouldn't shut the fuck up about it. You have to be retarded to think a Navajo is doing anything but huffing gasoline. If there is a single Navajo who uses 4chan it's not that guy. There's probably like ten Navajo in the entire country who know what 4chan even is.';
'For me it's 10-13ft wolf-folk ayys that eat bad guy lizard ayys, just like the buggy muck muck ayys do';
'>>37768284
based based based
so fucking based';
'>>37766917
Hey if it works then why not?';
'>>37768284
Weird that there's no dog aliens right. There's cat aliens and bug aliens, bug no dogs? I guess dogs kinda look too terrestrial.';
'undefined';
'>>37771029
bro let him in, he's just a little wet and cold';
'>>37707189';
'>>37771039
Would you warm him up?';
'Awoooo
Wurwulbes of Londi
Awoooo';
'>>37773098
yea of course, get the were-homie in the backseat, feed him some jerky, i dont mind wet dog smell, we good, if he wanna nap, he can nap';
'>>37707189
There's a thread on /trash/ some of you guys would love. A thread posted once every month at the time of the full moon.
>>65116764';
'>>37711695
any werewolf movie recommendation?
imo dog soldiers was a better movie than predator';
'>>37707189
Gen A ruined this board.';
'>>37708407
If you were an actual woman I'd gladly fuck your whore brains out. But you are a disgusting tranny. So I only bite you dead.';
'>>37707189
Werewolf husband wishing thread';
'>>37707655
Tell me more anon, I tried blasting your sequence but got nothing.';
'>>37777861
Gay guys exist, anon.';
'gayest thread on 4chan rn';
'>>37778512
you ever lurk /trash/?
>captcha: m2m ayy
fucking kek, never mind, you right';
'I saw a werewolf drinking a pina colada at Trader Vic’s';
'>>37781269
pic for proof';
'undefined';
'Awoooooooooooooooooooooooooooooooooooooooooooooooooooooooo woooooooo woooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo' ;
'>>37777968
Gay guys yes, gay werewolves no. I think one of the appeals of the werewolf is pure nature levels of animal lust that must be satisfied by ravaging a female mate. It is very interesting from a psychology perspective. I personally think it bellies frustration and a bit of insecurity with human mating. Its this complicated dance with lots of emotions and rules and entanglements when a lot of guys just wish they could FUCK and fuck well. Get rid of the bullshit and let nature take its course, and of course being a 7ft tall beast with a massive cock helps as well because in practice most of us really are 2 pump chumps with small cocks. Or maybe these are just my feelings.';
'>>37783927
>Or maybe these are just my feelings.
It's 100% this.';
'>>37707189TzMOeQ' ;
Posting this absolute classic
https://m.youtube.com/watch?v=1XALV
'>>37783302
awooooooooooooooooooooooo';
'I heard him howling around my kitchen door, but I didn’t let him in';
'>>37707189
that i such a fucking bad costume holy fuck lmao!';
'>>37707189
Werewolves were always a disgusting fetish for furries. Why the fuck would anyone ever want to become a foul smelling ugly hairy beast, and lose your mind every full moon?.
When you can be a insanely strong. peak magnetic and beautiful vampire with superhuman abilities, and have mind control powers in trade for an allergy to sun which you can cover with sunblock or umbrella.
Literally zero downsides to being a vamp.
Also;
Vampires rule
Werefags drool.';
'>>37786093
Vampires are unironically more gay than most(if not all) mythical creatures.';
}